| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
1 Research Institute of Genome-based Biofactory, National Institute of Advanced Industrial Science and Technology (AIST), Tsukisamu-Higashi, Toyohira-ku, Sapporo 062-8517, Japan
2 Graduate School of Agriculture, Hokkaido University, Kita-ku, Sapporo 060-8589, Japan
3 Laboratory of Electron Microscopy, Graduate School of Dentistry, Hokkaido University, Kita-ku, Sapporo 060-8586, Japan
Correspondence
Isao Yumoto
i.yumoto{at}aist.go.jp
 |
ABSTRACT |
|---|
 TOP ABSTRACT MAIN TEXTREFERENCES |
|---|
] (alkaliphiles) of the genus Bacillus. DNA–DNA hybridization revealed a low relatedness (14 %) of the isolate to its closest phylogenetic neighbour, Bacillus clausii. On the basis of phenotypic and chemotaxonomic characteristics, phylogenetic data and DNA–DNA relatedness data, it was concluded that K11T (=JCM 12663T=NCIMB 14023T) merits classification as the type strain of a novel species, for which the name Bacillus oshimensis sp. nov. is proposed.
The GenBank/EMBL/DDBJ accession number for the 16S rRNA gene sequence of Bacillus oshimensis K11T is AB188090.
|
MAIN TEXT |
|---|
|
TOPABSTRACTMAIN TEXTREFERENCES |
|---|
), lipid composition (Clejan et al., 1986) and cell wall composition (Aono & Horikoshi, 1983) using various alkaliphilic Bacillus strains have shown that the characteristics of these bacteria differ depending on the strain. These differences suggest that variations of the adaptation mechanism might exist in alkaliphilic Bacillus strains. On the basis of the given background information, it is very important to determine the taxonomic groupings of alkaliphilic Bacillus species and their phylogenetic relationships. More than 18 species of alkaliphilic Bacillus species have been identified to date (Vedder, 1934; Spanka & Fritze, 1993; Nielsen et al., 1995; Agnew et al., 1995; Fritze, 1996; Switzer Blum et al., 1998; Yumoto et al., 1998, 2003; Olivera et al., 2005). On the basis of a phylogenetic analysis done on 16S rRNA gene sequences, the species do not exhibit independent scattering but are instead grouped into three main clusters in the phylogenetic tree.
The presence of sodium ions (Na+) in the medium has been considered to be very important for the environmental adaptation of alkaliphilic Bacillus species to high pH (Krulwich et al., 2001). Physiological studies on their alkali adaptation revealed two types of Na+/H+ antiporter, Mrp (Sha) and NhaC, for lowering cytoplasmic pH. Alkaliphilic Bacillus species use Na+ for the adjustment of intracellular pH, solute transport and flagella rotation. The reason behind the existence of these antiporters in Bacillus species might be the avoidance of the H+ cycle in their solute transport system. However, not every strain of alkaliphilic Bacillus shows an obvious NaCl requirement. This might be explained by the variation of affinity for NaCl observed among the alkaliphilic Bacillus species. Species-specific differences in the halotolerance of the alkaliphilic bacilli have also been reported (Krulwich et al., 1982; Garcia et al., 1983).
In the present study, a halophilic and halotolerant alkaliphilic bacterium that produced various hydrolytic enzymes was isolated, with the aim of studying its physiological alkali adaptation mechanisms. Phenotypic and chemotaxonomic characteristics and a phylogenetic analysis based on 16S rRNA gene sequences showed that the new isolate merited classification as the type strain of a novel Bacillus species.
Soil samples were obtained from seven different sites in Hokkaido, Japan, from which 76 alkaliphilic bacterial strains were isolated using PYA plates made from stocks consisting of 8 g peptone (Kyokuto), 3 g yeast extract (Merck), 15 g agar, 1 g K2HPO4, 3·5 mg EDTA, 3 mg ZnSO4.7H2O, 10 mg FeSO4.7H2O, 2 mg MnSO4.nH2O, 1 mg CuSO4.5H2O, 2 mg Co(NO3)2.6H2O and 1 mg H3BO3 in 1 litre NaHCO3/Na2CO3 buffer (100 mM in deionized water; pH 10), and incubated at 27 °C (Yumoto et al., 1998). A halophilic and halotolerant strain, K11T, exhibiting a relatively low content of respiratory cytochromes (Yumoto et al., 1997) was selected for further characterization. In a previous report, the selected strain was named K011. The isolate originally came from soil obtained from Oshyamanbe, Oshima, Hokkaido, Japan. Cells for chemotaxonomic analysis were cultivated with reciprocal shaking (140 r.p.m.) at 27 °C and harvested at the late-exponential phase of growth. For comparison purposes, Bacillus clausii DSM 8716T, Bacillus sp. DSM 8714 and Bacillus sp. DSM 8717 were used as reference strains for DNA–DNA hybridization. These micro-organisms were cultivated in PYA broth medium containing 100 mM NaHCO3/Na2CO3 buffer (pH 10) and the same broth medium containing 100 mM NaH2PO4/Na2HPO4 buffer (pH 7).
For the phenotypic characterization, PYA medium was used as the basal medium. The culture was incubated at 27 °C for 2 weeks and experiments were performed three times. Acid production from carbohydrate was determined by the method of Hugh & Leifson (1953) using thymol blue (0·008 %, w/v) instead of bromothymol blue at pH 10. Growth experiments at pH 7–10 were performed using PYA medium containing 100 mM NaH2PO4/Na2HPO4 buffer (pH 7–8) or 100 mM NaHCO3/Na2CO3 buffer (pH 9–10). Other physiological and biochemical characteristics were examined according to the methods of Yumoto et al. (1998) and as described in Barrow & Feltham (1993).
For the observation of negatively stained cells by use of transmission electron microscopy (TEM), cells were grown on a PYA agar slant. The procedures for TEM preparation and observation have been described previously (Yumoto et al., 2001).
The analyses of whole-cell fatty acids and isoprenoid quinones were performed as described previously (Yumoto et al., 1998, 2001).
Bacterial DNA was prepared according to the method of Marmur (1961). The DNA base composition was determined by the method of Tamaoka & Komagata (1984). The level of DNA–DNA relatedness was determined fluorometrically by the method of Ezaki et al. (1989) using photobiotin-labelled DNA probes and black microplates. The temperature used for hybridization was 37·2 °C.
The 16S rRNA gene was amplified by using the PCR method with primers A (GGAGAGTTAGATCTTGGCTCAG) and 1541R (AAGGAGGTGATCCAGCC). The approximately 1·5 kb PCR product was sequenced directly by the dideoxynucleotide chain-termination method using a DNA sequencer (PRISM 3100; Applied Biosystems). Multiple alignments of the sequences were created and the nucleotide substitution rate (Knuc value) was calculated. A phylogenetic tree was constructed by the neighbour-joining method (Kimura, 1980; Saitou & Nei, 1987) using the CLUSTAL W program (Thompson et al., 1994). Similarity values for sequences were calculated using the GENETYX computer program (Software Development).
The morphological, physiological and biochemical characteristics of strain K11T are given in the species description. The isolate was revealed to be Gram-positive and produced ellipsoidal spores terminally positioned within a sporangium, which was not swollen. Electron microscopy (TEM) observation showed that cells were non-flagellated rods (0·7–0·9x1·1–4·4 µm).
The results of GLC analyses of the fatty acids of strain K11T grown at pH 7 and pH 10 are shown in Table 1. The fatty acids were mostly of the branched type. Differences in the unsaturated fatty acid composition and the anteiso : iso-branched fatty acid ratio were observed between cells grown at pH 7 and pH 10.
|
). The results of this analysis suggested that strain K11T is a member of group 6 (Nielsen et al., 1994) (alkaliphiles) of the genus Bacillus. Among strains of species with validly published names, strain K11T showed the highest sequence similarity with B. clausii DSM 8716T (94·7 %). The 16S rRNA gene sequence of the isolate was also similar to those of Bacillus gibsonii DSM 8722T (93·4 %), Bacillus alcalophilus DSM 485T (94·5 %) and Bacillus pseudalcaliphilus DSM 8725T (93·8 %). Although Bacillus sp. DSM 8714 and Bacillus sp. DSM 8717 have been studied taxonomically, they have not been identified as new species because it was thought that the phenotypic data for these strains were insufficient to provide diagnostic features (Nielsen et al., 1995). Strain K11T also exhibited high sequence similarity with Bacillus sp. DSM 8717 (98·5 %) and Bacillus sp. DSM 8714 (95·7 %).
|
According to the sequence similarity values and results of the phylogenetic analysis based on its 16S rRNA gene sequence, strain K11T is most closely related to B. clausii DSM 8716T. Therefore, DNA–DNA hybridizations between strain K11T and B. clausii DSM 8716T and phylogenetic neighbour strains Bacillus sp. DSM 8717 and Bacillus sp. DSM 8714 were performed. DNA–DNA hybridization data indicated that the isolate is distinct from B. clausii DSM 8716T (14·0 % similarity) and Bacillus sp. DSM 8714 (21·6 %). However, it is very similar to Bacillus sp. DSM 8717 (67·6 %). The similarity value with strain DSM 8717 was reproducible. Therefore, it is considered that strain DSM 8717 represents a different species from strain K11T.
Strain K11T can be differentiated from other phylogenetic neighbours of previously reported alkaliphilic Bacillus species on the basis of several phenotypic and chemotaxonomic characteristics (Table 2); it can be differentiated from Bacillus sp. DSM 8717 by seven characteristics.
|
; Oren, 2001). Although several alkaliphilic bacteria have been identified, no species has been reported that exhibits non-motile characteristics. Therefore, strain K11T is the first example of a non-motile, alkaliphilic Bacillus. The isolate obviously exhibited an NaCl requirement for growth. The strain may require NaCl for pH homeostasis for adaptation in an alkali environment or for energy production through the respiratory chain (Tokuda & Unemoto, 1981, 1984) or ATPase (Ueno et al., 2000). On the basis of the above results, it is proposed that strain K11T be classified as the type strain of a novel species, Bacillus oshimensis sp. nov.
Description of Bacillus oshimensis sp. nov.
Bacillus oshimensis (o'shi.men.sis. N.L. masc. adj. oshimensis from Oshima, the region where the micro-organism was isolated).
Grows at pH 7–10. Growth rate and intensity at pH 10 are better than those at pH 7. Non-motile, Gram-positive, aerobic straight rods (0·7–0·9x1·1–4·4 µm) that produce terminally located ellipsoidal spores which do not swell the sporangium. Colonies are circular and white. Grows in 0–20 % NaCl, with the optimum concentration 7 % NaCl. Growth intensity is weak in 0–3 % NaCl. NaCl is required for good growth. The growth temperature range is 13–41 °C; the optimum growth temperature range is 28–32 °C at pH 10. Catalase-positive and oxidase-positive. Negative for the deamination of phenylalanine, reduction of nitrate and ONPG hydrolysis. Positive for the hydrolysis of casein, gelatin, starch, 4-methylumbelliferone glucuronide (4-MUG) DNA and Tweens 20, 40, 60 and 80. Negative for the hydrolysis of aesculin, pullulan and hippurate. Acid, but no gas, is produced from D-xylose, ribose, glycerol, maltose, D-mannose, melibiose, raffinose, mannitol, xylitol and trehalose when grown at pH 10. No acid is produced from D-arabinose, D-fructose, sucrose, myo-inositol, meso-erythritol, sorbitol, dulcitol, lactose or cellobiose. The major isoprenoid quinone is menaquinone-7. The cellular fatty acid profile consists of significant amounts of C15 branched-chain acids, iso C15 : 0 and anteiso C15 : 0. The DNA G+C content is 40·8 mol%.
The type strain is K11T (=JCM 12663T=NCIMB 14023T).
|
REFERENCES |
|---|
|
TOPABSTRACTMAIN TEXTREFERENCES |
|---|
Aono, R. & Horikoshi, K. (1983). Chemical composition of cell walls of alkalophilic strains of Bacillus. J Gen Microbiol 129, 1083–1087.
Barrow, G. I. & Feltham, R. K. A. (editors) (1993). Cowan and Steel's Manual for the Identification of Medical Bacteria, 3rd edn. Cambridge: Cambridge University Press.
Clejan, S., Krulwich, T. A., Mondrus, K. R. & Seto-Young, D. (1986). Membrane lipid composition of obligately and facultatively alkalophilic strains of Bacillus spp. J Bacteriol 168, 334–340.
Ezaki, T., Hashimoto, Y. & Yabuuchi, E. (1989). Fluorometric deoxyribonucleic acid-deoxyribonucleic acid hybridization in microdilution wells as an alternative to membrane filter hybridization in which radioisotopes are used to determine genetic relatedness among bacterial strains. Int J Syst Bacteriol 39, 224–229.
Garcia, M. L., Guffanti, A. A. & Krulwich, T. A. (1983). Characterization of Na+/H+ antiporter of alkalophilic bacilli in vivo: 
-dependent 22Na+ efflux from whole cells. J Bacteriol 156, 1151–1157.
Fritze, D. (1996). Bacillus haloalkaliphilus sp. nov. Int J Syst Bacteriol 46, 98–101.
Hugh, R. & Leifson, E. (1953). The taxonomic significance of fermentative versus oxidative metabolism of carbohydrates by various gram negative bacteria. J Bacteriol 66, 24–26.
Kimura, M. (1980). A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences. J Mol Evol 16, 111–120.[CrossRef][Medline]
Krulwich, T. A., Guffanti, A. A., Bornstein, R. F. & Hoffstein, J. (1982). A sodium requirement for growth, solute transport, and pH homeostasis in Bacillus firmus RAB. J Biol Chem 257, 1885–1889.
Krulwich, T. A., Ito, M. & Guffanti, A. A. (2001). The Na+-dependence of alkaliphily in Bacillus. Biochim Biophys Acta 1505, 158–168.[Medline]
Kushner, D. J. (1978). Life in high salt and solute concentrations: halophilic bacteria. In Microbial Life in Extreme Environments, pp. 317–368. Edited by D. J. Kushner. London: Academic Press.
Marmur, J. (1961). A procedure for the isolation of deoxyribonucleic acid from microorganisms. J Mol Biol 3, 208–218.
Nielsen, P., Rainey, F. A., Outtrup, H., Priest, F. G. & Fritze, D. (1994). Comparative 16S rDNA sequence analysis of some alkaliphilic bacilli and the establishment of sixth rRNA group within the genus Bacillus. FEMS Microbiol Lett 117, 61–66.[CrossRef]
Nielsen, P., Fritze, D. & Priest, F. G. (1995). Phenetic diversity of alkaliphilic Bacillus strains: proposal for nine new species. Microbiology 141, 1745–1761.
Olivera, N., Siñeriz, F. & Breccia, J. D. (2005). Bacillus patagoniensis sp. nov., a novel alkalitolerant bacterium from the rhizosphere of Atriplex lampa in Patagonia, Argentina. Int J Syst Evol Microbiol 55, 443–447.
Oren, A. (2001). Life at high salt concentrations. In The Prokaryotes: an Evolving Electronic Resource for the Microbiological Community, 3rd edn, release, 3.1, 20 January 2000. Edited by M. Dworkin et al. New York: Springer. http://link.springer-ny.com/link/service/book/10125/
Saitou, N. & Nei, M. (1987). The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol Biol Evol 4, 406–425.[Abstract]
Spanka, R. & Fritze, D. (1993). Bacillus cohnii sp. nov., a new, obligately alkaliphilic, oval-spore-forming Bacillus species with ornithine and aspartic acid instead of diaminopimelic acid in the cell wall. Int J Syst Bacteriol 43, 150–156.
Switzer Blum, J., Burns Bindi, A., Buzzelli, J., Stolz, J. F. & Oremland, R. S. (1998). Bacillus arsenicoselenatis sp. nov., and Bacillus selenitireducens, sp. nov.: two haloalkaliphiles from Mono Lake, California that respire oxyanions of selenium and arsenic. Arch Microbiol 171, 19–30.[CrossRef][Medline]
Tamaoka, J. & Komagata, K. (1984). Determination of DNA base composition by reversed-phase high-performance liquid chromatography. FEMS Microbiol Lett 25, 125–128.
Thompson, J. D., Higgins, D. G. & Gibson, T. J. (1994). CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res 22, 4673–4680.
Tokuda, H. & Unemoto, T. (1981). A respiration-dependent primary sodium extruction system functioning at alkaline pH in the marine bacterium Vibrio alginolyticus. Biochem Biophys Res Commun 102, 265–271.[CrossRef][Medline]
Tokuda, H. & Unemoto, T. (1984). Na+ is translocated at NADH : quinone oxidoreductase segment in the respiratory chain of Vibrio alginolyticus. J Biol Chem 259, 7785–7790.
Ueno, S., Kaieda, N. & Koyama, N. (2000). Characterization of P-type Na+-ATPase of facultatively anaerobic alkaliphile, Exiguobacterium aurantiacum. J Biol Chem 275, 14537–14540.
Vedder, A. (1934). Bacillus alcalophilus n. sp.; benevens enkele ervaringen met sterk alcalische voedingbodems. Antonie Leeuwenhoek J Microbiol Serol 1, 141–147.
Yumoto, I., Nakajima, K. & Ikeda, K. (1997). Comparative study on cytochrome content of alkaliphilic Bacillus strains. J Ferment Bioeng 83, 466–469.[CrossRef]
Yumoto, I., Yamazaki, K., Sawabe, T., Nakano, K., Kawasaki, K., Ezura, Y. & Shinano, H. (1998). Bacillus horti sp. nov., a new gram-negative alkaliphilic bacillus. Int J Syst Bacteriol 48, 565–571; erratum (1999) 49, 1951.
Yumoto, I., Yamazaki, K., Hishinuma, M., Nodasaka, Y., Suemori, A., Nakajima, K., Inoue, N. & Kawasaki, K. (2001). Pseudomonas alcaliphila sp. nov., a novel facultatively psychrophilic alkaliphile isolated from seawater. Int J Syst Evol Microbiol 51, 349–355.[Abstract]
Yumoto, I., Yamaga, S., Sogabe, Y., Nodasaka, Y., Matsuyama, H., Nakajima, K. & Suemori, A. (2003). Bacillus krulwichae sp. nov., a halotolerant obligate alkaliphile that utilizes benzoate and m-hydroxybenzoate. Int J Syst Evol Microbiol 53, 1531–1536.
This article has been cited by other articles:
|
|
 |
|
  J.-C. Lee, G. S. Lee, D.-J. Park, and C.-J. Kim Bacillus alkalitelluris sp. nov., an alkaliphilic bacterium isolated from sandy soil Int J Syst Evol Microbiol, November 1, 2008; 58(11): 2629 - 2634. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Aino, K. Hirota, T. Matsuno, N. Morita, Y. Nodasaka, T. Fujiwara, H. Matsuyama, K. Yoshimune, and I. Yumoto Bacillus polygoni sp. nov., a moderately halophilic, non-motile obligate alkaliphile isolated from indigo balls Int J Syst Evol Microbiol, January 1, 2008; 58(1): 120 - 124. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Usami, A. Echigo, T. Fukushima, T. Mizuki, Y. Yoshida, and M. Kamekura Alkalibacillus silvisoli sp. nov., an alkaliphilic moderate halophile isolated from non-saline forest soil in Japan Int J Syst Evol Microbiol, April 1, 2007; 57(4): 770 - 774. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Ghosh, M. Bhardwaj, T. Satyanarayana, M. Khurana, S. Mayilraj, and R. K. Jain Bacillus lehensis sp. nov., an alkalitolerant bacterium isolated from soil Int J Syst Evol Microbiol, February 1, 2007; 57(2): 238 - 242. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. A. Bakir, M. Kitahara, M. Sakamoto, M. Matsumoto, and Y. Benno Bacteroides finegoldii sp. nov., isolated from human faeces. Int J Syst Evol Microbiol, May 1, 2006; 56(Pt 5): 931 - 935. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Nogi, H. Takami, and K. Horikoshi Characterization of alkaliphilic Bacillus strains used in industry: proposal of five novel species Int J Syst Evol Microbiol, November 1, 2005; 55(6): 2309 - 2315. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
I. Romano, L. Lama, B. Nicolaus, A. Gambacorta, and A. Giordano Alkalibacillus filiformis sp. nov., isolated from a mineral pool in Campania, Italy Int J Syst Evol Microbiol, November 1, 2005; 55(6): 2395 - 2399. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |
