Supplementary phylogenetic data
Highly organized structure in the non-coding region of the psbA minicircle from clade C Symbiodinium, by R. B. Moore, K. M. Ferguson, W. K. W. Loh, O. Hoegh-Guldberg and D. A. Carter
International Journal of Systematic and Evolutionary Microbiology vol. 53, part 6, pp. 1725-1734
PowerPoint file
Phylogenetic trees showing LSU rDNA relatedness of Symbiodinium strains from a range of coral hosts from One Tree Island (OTI), Great Barrier Reef, Australia, and comparison to reference strains. The sequences consisted of approximately 385 bp from the D1/D2 regions of LSU rDNA, which were amplified using the D1/D2 primers of Zardoya et al. (1995) (J Mol Evol 41, 637-645), or primers zooxD1 [CCTCAGTAATGGCGAATGAACA] and zoox D2 [CCTTGGTCCGTGTTTC-AAGA] (Carter et al., 2000; Australian Society for Microbiology meeting). The alignment was generated with ClustalX (Thompson et al., 1997; Nucleic Acids Res 24, 4876-4882), then modified by hand using Bioedit (Hall, 1999, Nucleic Acids Symp Ser 41, 95-98). Positions with nucleotide N were deleted before tree construction. Phylogenetic analysis was performed using programs available within BioManager, ANGIS (http://www.angis.org.au). Genetic distance between strains was used as the basis for selecting strains Sym-Ha, -Lp, -Gt and -Pd for our study of the psbA minicircle non-coding region. (A) Neighbour-joining (NJ) tree constructed using distance optimality criteria with the PHYLIP program (Felsenstein, 1989; Cladistics 5, 164-166). Evolutionary distances were calculated using the Kimura two-parameter model of nucleotide change. Of 100 bootstrap resamplings, only values above 50% are reported. This tree identifies selected OTI zooxanthellae strains as clade C Symbiodinium, by reference to a clade C standard (GenBank accession no. U63485; Baker, 1999; PhD dissertation, University of Miami) (B) Maximum-likelihood tree from the same alignment as A, and also calculated using PHYLIP and the Kimura substitution model. Topology is similar to the NJ tree. (C) Fine-scale NJ tree (unrooted) generated by the methods as A. The zooxanthellae of hosts Ha, Lp and Gt are genetically close to each other, compared to other clade C zooxanthellae from OTI, and were chosen for the psbA minicircle analysis on this basis.
Sym-Gt and -Ha from our site at One Tree Island atoll have been differentiated into two minor ITS subclades (clade C nest 1-1 and clade C nest 1-6 respectively) by Rodriguez-Lanetty (2003) (Mol Phylogenet Evol 28, 152-168), on the basis of three comparative mutations in ITS1.
Key to organisms and GenBank accessions (Sym- means 'symbiont of'), Sym-: Gt1 & Gt2, Goniopora tenuidens (AY237297, AY258905); Ha, Heliofungia actiniformis (AY258903); Lp, Leptastrea purpurea (AY258904); Pd, Pocillopora damicornis (AY258906); Am, Acropora millepora (AY237296); Pc, Porites cylindrica (AY258902); Sp, Stylophora pistillata (AY258901); Sh, Seriatopora hystrix (AF349550). Zooxanthellae that are labelled Sym-, were collected from hosts at OTI. Outgroups are Gymnodinium beii (GenBank no. AF060900; Wilcox, 1998; Mol Phylogenet Evol 10, 436-448), clade A Symbiodinium (U63480; Baker 1999), clade B Symbiodinium (U63484; Baker 1999) and a Symbiodinium strain from a foraminiferan (phylotype Fr1, AJ291520; Pochon et al., 2001; Mar Biol 139, 1069-1078). The latter was bracketed within clade C by Pochon et al., but grouped discreetly from other clade C strains in that analysis and this.
PowerPoint file
© 2003 IUMS
