IJSEM IJSEM eTOCs
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Acedo-Félix, E.
Right arrow Articles by Pérez-Martínez, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Acedo-Félix, E.
Right arrow Articles by Pérez-Martínez, G.
Agricola
Right arrow Articles by Acedo-Félix, E.
Right arrow Articles by Pérez-Martínez, G.
Int J Syst Evol Microbiol 53 (2003), 67-75; DOI  10.1099/ijs.0.02325-0
© 2003 International Union of Microbiological Societies

Significant differences between Lactobacillus casei subsp. casei ATCC 393T and a commonly used plasmid-cured derivative revealed by a polyphasic study

Evelia Acedo-Félix{dagger} and Gaspar Pérez-Martínez

Departamento de Biotecnología, Instituto de Agroquímica y Tecnología de Alimentos (CSIC), Apartado de Correos 73, 46100 – Burjassot, Valencia, Spain

Correspondence
Gaspar Pérez-Martínez
gaspar.perez{at}iata.csic.es


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS AND DISCUSSION
 REFERENCES
 
Many studies on Lactobacillus casei subsp. casei (L. casei) have been carried out using strain ATCC 393 (pLZ15-). Four strains of L. casei ATCC 393T and three of ATCC 393 (pLZ15-) were compared using phenotypic methods and many of the available genotyping techniques. These tests showed that strains of ATCC 393T obtained from independent public type-culture collections were significantly different from the plasmid-free (pLZ15-) strains of ATCC 393T. These findings were confirmed by sequencing the first 580 nt (domain I) of the 16S and 23S rDNAs of the strains. Complete sequencing of the 16S rDNA of one representative strain from each group revealed that strain ATCC 393T from culture collections was 99 % similar to Lactobacillus zeae ATCC 15820T and that the strain so far considered as L. casei ATCC 393 (pLZ15-) was, in turn, 100 % similar to L. casei ATCC 334 and Lactobacillus paracasei subsp. paracasei ATCC 4022. All data obtained in this work indicate that the ancestral strain of ATCC 393 (pLZ15-) might never have been the strain that is now available from culture collections.


Abbreviations: ARDRA, amplified rDNA restriction analysis; ITS, intergenic spacer sequence; L. casei, L. casei subsp. casei; RAPD analysis, random amplified polymorphic DNA

The GenBank accession numbers for the partial 23S rDNA sequences of BL 23 and BL 94T are AY112675 and AY112676, respectively; the GenBank accession numbers for the 16S rDNA sequences of BL 23 [ATCC 393 (pLZ15-)] and BL 94T (ATCC 393T) are AF385770 and AF469172, respectively.

{dagger}Present address: Centro de Investigación en Alimentación y Desarrollo, AC, 83000 Hermosillo, Sonora, Mexico. Back


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS AND DISCUSSION
 REFERENCES
 
Strains belonging to the species Lactobacillus casei can be isolated from very different environments, and some of them are now used as probiotics in commercial products. This species is currently involved in a serious controversy and is the subject of numerous taxonomic studies, because many strains previously characterized as L. casei show genotypic, phenotypic and phylogenetic differences when compared to the standing type strain of the species, L. casei subsp. casei ATCC 393T (Mills & Lessel, 1973Go; Dellaglio et al., 1975Go, 1991Go; Dicks et al., 1996Go; Collins et al., 1989Go; Ferrero et al., 1996Go; Mori et al., 1997Go; Zhong et al., 1998Go; Chen et al., 2000Go; Felis et al., 2001Go).

L. casei has been used in a number of pioneering studies on the physiology and genetics of the genus Lactobacillus. The type strain L. casei subsp. casei (L. casei) ATCC 393T especially has been used in studies on the fermentation of glucose, lactose, citrate and pyruvate (Hegazi & Abo-Elanga, 1987Go; Palles et al., 1998Go), comparative studies on and molecular characterization of the enzyme L-lactate dehydrogenase (Gordon & Doelle, 1976Go; Hensel et al., 1977Go; Kim et al., 1991Go), characterization of an intracellular {beta}-glucosidase (Coullon et al., 1998Go), proteolytic activity (Hegazi & Abo-Elanga, 1987Go) and studies on the composition of the cell wall, antibiotic resistance and adherence factors (Billot-Klein et al., 1997Go; Pelletier et al., 1997Go). Also, the isolation and characterization of extrachromosomal genetic elements in the genus Lactobacillus was reported for the first time in strains of L. casei, such as ATCC 393T, 61BG, 64H, ATCC 334, ATCC 4646 and ATCC 15820T (Chassy et al., 1976Go; Chassy & Giuffrida, 1980Go; Lee-Wickner & Chassy, 1984Go, 1985Go). Flickinger et al. (1986)Go obtained a number of plasmid-cured derivatives from L. casei strains; among these, an ATCC 393T variant cured of plasmid pLZ15 [ATCC 393 (pLZ15-)], which encodes a lactose permease and {beta}-galactosidase, was found (Chassy & Alpert, 1989Go). Besides the added value of being a derivative of the standing type strain, this plasmid-cured strain showed a great potential for studies on lactose metabolism, as it still carried a second lactose-specific transport and hydrolysis system, the lactose phosphoenolpyruvate : phosphotransferase system (PTS) and a 6-phospho-{beta}-galactosidase. It was soon shown by the same research laboratory that this strain was amenable to genetic transformation by electroporation (Chassy & Flickinger, 1987Go). From this point in time, L. casei ATCC 393 (pLZ15-) became widely used in genetic and physiological studies on L. casei and it has been used for the characterization of lactose, glucose, xylose and sorbose transport and metabolism (Hemme et al., 1994Go; Veyrat et al., 1994Go; Gosalbes et al., 1997Go, 1999Go; Chaillou et al., 1999Go; Yebra et al., 2000Go), the characterization of the role of the general components of the PTS and other elements involved in carbon catabolism repression (Monedero et al., 1997Go; Gosalbes et al., 1997Go, 1999Go; Yebra et al., 2000Go; Viana et al., 2000Go; Dossonnet et al., 2000Go), as well as for the design of cloning and integration vectors (Leer et al., 1992Go; Alvarez et al., 1999Go; Gosalbes et al., 2000Go, 2001Go; Pérez-Arellano et al., 2001Go) and the characterization of protein secretion (Hols et al., 1997Go; Maassen et al., 1999Go).

As mentioned earlier, recent taxonomic studies using wild-type L. casei ATCC 393T have shown this strain to be phylogenetically more closely related to Lactobacillus zeae ATCC 15820T than to most other strains grouped in the L. casei–paracasei phylum (Dellaglio et al., 1975Go, 1991Go; Dicks et al., 1996Go; Collins et al., 1989Go; Ferrero et al., 1996Go; Mori et al., 1997Go; Zhong et al., 1998Go). The present study was prompted by the observation that, in daily laboratory work, certain differences were found between strain ATCC 393T – directly obtained from public culture collections – and the plasmid-cured derivative ATCC 393 (pLZ15-). Hence, strains of ATCC 393 (pLZ15-) were gathered from the laboratory of Professor B. Chassy and from two other research laboratories, so that they could be compared to four isolates of L. casei ATCC 393T obtained from different culture collections. Recently developed molecular techniques have been applied in this study as part of a polyphasic approach to correctly identify strains of L. casei ATCC 393 (pLZ15-), which are currently in use in many laboratories around the world. This study also constitutes an interesting exercise for comparing the different available rapid molecular techniques and for determining their respective resolving potentials among closely related strains.


    METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS AND DISCUSSION
 REFERENCES
 
Strains and culture conditions.
Strains included in this study were obtained from different research laboratories and culture collections as strain L. casei ATCC 393T (Table 1Go). They were maintained in a 10 % glycerol stock collection at -80 °C and were subcultured in MRS medium (Oxoid) when required.


View this table:
[in this window]
[in a new window]
 
Table 1. Bacterial strains used in this study

 
Phenotypic characterization.
Ability of the strains to grow at 15 and 45 °C was determined in MRS broth. Cultures were examined at 24 and 48 h post-inoculation and positive growth was recorded as OD550 values >1·0 (++) and OD550 values >0·1 (+). Exopolysaccharide production was determined using the medium described by Stingele et al. (1996)Go. The patterns of sugar fermentation were determined by using the API 50CHL system (BioMérieux) and, as an additional phenotypic test, catalase production was assayed. The Gram stain of the bacterial cells was determined as described by Murray et al. (1994)Go.

DNA extraction.
Cultures were grown overnight at 37 °C in MRS broth. The protocol used for DNA extraction was as described by Veyrat et al. (1999)Go. Purity of DNA was checked by determining the A260/280 value and by agarose gel electrophoresis. Purified DNA was aliquoted and stored at 4 °C. Plasmid DNA extraction was performed according to Anderson & McKay (1983)Go.

Random amplified polymorphic DNA analysis (RAPD).
PCR for RAPD was carried out as described by Veyrat et al. (1999)Go. Four oligonucleotides were used for the RAPD, ArgDei (ACCYTRGAAGGYGGYGATGTB), FAD1 (GGWTTTATCKCAGCWTTGG), ISS1Rev (GGATCCAAGACAACGTTTCAAA) and OPL5 (ACGCAGGCAC). Each reaction was performed in a total volume of 50 µl containing 50 pmol primer, 10 mM each dNTP, 1·0 U Taq DNA polymerase and 1·0xTaq buffer (both DyNAzyme II DNA Polymerase; Finnzymes). For numerical analyses of the banding patterns, photographs of the gels were scanned using an HP ScanJet 5100C scanner (Hewlett Packard) with the HPRSCAN software (Software HP Precision Scan, version 1.01). Digitalized gel images were analysed using TDI Lane Manager 2.1 and ADA (Advanced Dates Analyses) (TDI, SA, Spain, 1996). Numerical analyses of the banding patterns were performed according to Welsh & McClelland (1990)Go, and the similarity coefficient and evolutionary distances were calculated.

Ribotyping.
Total DNA (10 µg) from each strain was digested with EcoRI, HindIII and PstI (GibcoBRL), according to the manufacturer's instructions. To get a good resolution of the hybridization bands, the digested DNA samples were separated by gel electrophoresis in 1xTBE buffer using 0·8 % (w/v) agarose for the EcoRI and HindIII digests and 0·5 % agarose for the PstI digest. DNA fragments were transferred to nylon membranes (Hybond+; Amersham-Pharmacia Biotech) by the capillary blot procedure (Sambrook et al., 1989Go). The hybridization probe was obtained by amplification of the 16S rDNA from L. casei ATCC 393T with oligonucleotides 27f (AGAGTTTGATCCTGGCTCAG) and 1492r (TACGGCACCTTGTTACGACTT) (Lane, 1991Go). PCR amplification was carried out in a thermal cycler (REAL) using 30 cycles at 94 °C for 1 min, 55 °C for 45 s and 70 °C for 1·5 min, with a final extension at 70 °C for 10 min. The components of the reaction mixture were the same as described above, but in a final volume of 100 µl. After electrophoresis through a 1·0 % (w/v) agarose gel, the DNA fragment obtained from the PCR was purified using the Gene CleanII Kit (Bio 101). Labelling of the fragment with digoxigenin-11-dUTP, overnight hybridization at 55 °C and immunological detection were carried out using the Random Primed DNA labelling and Detection Kit (Boehringer Mannheim), according to the manufacturer's instructions. Digoxigenin-labelled DNA molecular marker II (Boehringer Mannheim) was used as the size standard.

Amplified rDNA restriction analysis (ARDRA).
16S rDNA from the strains under study was amplified as described above. Aliquots (20 µl) of the amplified DNA were digested with the restriction enzymes AluI and HinfI (GibcoBRL). The bands were then resolved through 2·0 % (w/v) agarose gels using the 1 kb plus DNA ladder (GibcoBRL) as the size standard.

Macrorestriction and PFGE.
DNA isolation by gentle lysis of agarose-embedded bacterial cells and enzyme digests for PFGE were performed according to Tenreiro et al. (1994)Go. For each agarose disc, 10 U AscI, 10 U SfiI and 4U I-CeuI (New England Biolabs) were used. PFGE was performed using the CHEF-MAPPER system (Bio-Rad) with 1·0 % (w/v) agarose gels (Seakem GTG; FMAC) in 0·5xTBE (45 mM Tris, 45 mM boric acid, 1 mM EDTA pH 8·0) at 14 °C. A constant voltage (6 V cm-1) was applied to the system and fragment separation was performed using a two-phase programme. In the first phase, the pulse times increased progressively from 5 to 30 s for 8 h; in the second phase, the pulse times increased from 30 to 90 s for 12 h. The Lambda Ladder PFG Marker and Low Range PFG Marker (New England BioLabs) were used as molecular size markers and were always loaded in at least two lanes flanking the samples in the gels. Gels were stained in ethidium bromide (0·5 µg ml-1 in water) and photographed under UV illumination.

Calculation of the genome sizes.
The mean size of each fragment was estimated from three repetitions, using linear interpolation as proposed by Heath et al. (1992)Go. The presence of double bands was assessed by visual evaluation of the ethidium bromide stain.

Intergenic spacer sequences (ITS1 and ITS2).
Amplification of the intergenic spacer sequence 1 (ITS1), between the 16S and 23S rRNA genes, and intergenic spacer sequence 2 (ITS2), between the 23S and 5S rRNA genes, was carried out according to Nour (1998)Go. The conditions and PCR mixture used to amplify the ITSs were as described above. The fragment corresponding to ITS1 was amplified using primers ITS1f (5'-TGGATCACCTCCTTTCTA-3') and ITS1r (5'-GTGCGCCCTTTATTAACTT-3'), and the fragment corresponding to ITS2 was amplified using primers ITS2f (5'-CTTAACTTCTGTGTTCGGCATG-3') and ITS2r (5'-CTAATAGGTCGAGGACTTGACCAA-3'). PCR products corresponding to both ITSs were separated by electrophoresis through a 1·0 % (w/v) agarose gel and visualized by UV illumination after ethidium bromide staining.

Amplification and sequencing of the complete 16S rDNA and domain I of the 16S and 23S rDNAs.
Complete 16S rDNA was amplified as described above; it was completely sequenced using primers 27f (AGAGTTTGATCCTGGCTCAG), 1492r (TACGGCACCTTGTTACGACTT), 530f (GTGCCAGCMGCCGCGG), 1100r (GGGTTGCGCTCGTTG) and 1114f (GCAACGAGCGCAACCC). Primers used for amplification and sequencing of domain I of the 16S rDNA were 27f and 558r (GTATTACCGCGGCTG); those used for domain I of the 23S rDNA were 22f (CGGTGGATGCCTTGGC) and 559r (CATTMTACAAAAGGYACGC). PCR products were purified by electrophoresis through a 1·2 % (w/v) agarose gel, and the resulting DNA bands were extracted by using GFX PCR DNA and the Gelo Band Purification Kit (Amersham Pharmacia Biotech) according to manufacturer's instructions. All of the DNA fragments were sequenced using a Taq DyeDeoxy Terminator Cycle Sequencing Kit (Applied Biosystems) and an ABI 310 automatic sequencer (Perkin Elmer). The DNAMAN for Windows sequence analysis software (Lynnon BioSoft) was used for sequence assembly; subsequent sequence alignments with sequences retrieved from the NCBI (http://www.ncbi.nlm.nih.gov/), GenBank and the Ribosomal Database Project (RDP) using BLASTN were created using DNAMAN.


    RESULTS AND DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS AND DISCUSSION
 REFERENCES
 
Phenotypic analysis
All of the strains studied were Gram-positive, rod-shaped cells, which were grouped in pairs or chains. All seven strains tested were catalase-negative and produced acid from galactose, D-glucose, D-fructose, D-mannose, mannitol, N-acetyl-D-glucosamine, amygdalin, arbutin, aesculin, salicin, cellobiose, maltose, lactose, trehalose, {beta}-gentibiose, D-tagatose and gluconate. None of them fermented erythritol, D- or L-arabinose, D- or L-xylose, methyl {beta}-D-xyloside, rhamnose, dulcitol, inositol, methyl {alpha}-D-mannoside, methyl {alpha}-D-glucoside, melibiose, inulin, D-raffinose, starch, glycogen, xylitol, D- or L-fucose, D- or L-arabitol, or 5-ketogluconate. However, differences in the fermentation of nine sugars were detected among the seven strains, in addition to differences in their ability to grow at 15 °C and their exopolysaccharide production (Table 2Go).


View this table:
[in this window]
[in a new window]
 
Table 2. Variable phenotypic traits of the L. casei ATCC 393T strains

Strains: 1, BL 6T; 2, BL 23; 3, BL 27; 4, BL 54; 5, BL 70T; 6, BL 94T; 7, BL 119T. -, Negative; +, positive. For growth assays, + represents an OD550 value >0·1 and ++ represents an OD550 value >1·0.

 
Sugar fermentation tests were compared with those obtained previously, which were stored in the laboratory database. We obtained two phenons upon comparing the fermentation test results, both of which were identified as L. casei. The first phenon (identification score, 0·5) included strains BL 6T, BL 70T, BL 94T and BL 119T, which had been obtained from public culture collections as the wild-type strain ATCC 393T. The second phenon (identification score, 0·9995) included all of the ATCC 393 (pLZ15-) strains, namely BL 23, BL 27 and BL 54 (Flickinger et al., 1986Go). Other relevant phenotypic differences between the two phenons included faster growth of the plasmid-cured strains at 15 °C and greater exopolysaccharide production by the wild-type strains of L. casei ATCC 393T. These initial results demonstrated the phenotypic heterogeneity between the two groups of strains compared in this work. Further tests were carried out to ascertain the genotypic relatedness or differences between the two phenons. From this point on, the two groups of strains will be simply referred to as ATCC 393T and ATCC 393 (pLZ15-).

Genotypic characterization
Plasmid profile.
This was identical for the group of four ATCC 393T strains and consisted of six bands, which probably corresponded to different plasmid forms and more than one plasmid (Fig. 1Go). This contrasted with data from Lee-Wickner & Chassy (1985)Go, who reported the presence of a single plasmid in wild-type L. casei ATCC 393T. As expected, strains belonging to the ATCC 393 (pLZ15-) group had no plasmids.



View larger version (82K):
[in this window]
[in a new window]
 
Fig. 1. Agarose gel image showing the plasmid profiles of the seven isolates used in this study. Plasmid DNA bands are numbered on the right-hand side of the image. The gel was loaded as follows: M, size standard ({lambda} phage digested with PstI; 1, BL 23, L. casei ATCC 393 (pLZ15-); 2, BL 27, L. casei ATCC 393 (pLZ15-); 3, BL 54, L. casei ATCC 393 (pLZ15-); 4, BL 6T, L. casei ATCC 393T; 5, BL 70T, L. casei ATCC 393T; 6, BL 94T, L. casei ATCC 393T; 7, BL 119T, L. casei ATCC 393T.

 
RAPD.
Genomic fingerprints were obtained by RAPD for all seven of the strains studied here, using four different primers (ArgDei, FAD1, ISSRev and OPL5). Numerical analyses of the banding patterns showed the strains to cluster in two well-defined groups, which clearly separated ATCC 393T strains from ATCC 393 (pLZ15-) strains. Using the RAPD coefficient designed by Clark & Lanigan (1993)Go, the calculated similarity indexes between both groups were different for each oligonucleotide (98·9 % with OPL5; 99 % with FAD1 and ISSRev; 99·6 % with ArgDei). When data from all of the primers were integrated in a single analysis, the similarity index was 99·51 %. As an illustration, Fig. 2Go shows the RAPD patterns produced when the primer ISSRev was used for all of the strains. At the taxonomic level, RAPD can be seen to be as discriminative as the phenotypic analysis.



View larger version (81K):
[in this window]
[in a new window]
 
Fig. 2. RAPD patterns produced with primer ISSRev for the strains studied here. Lanes: M, size standard ({lambda} phage digested with PstI; 1, BL 6T, L. casei ATCC 393T; 2, BL 23, L. casei ATCC 393 (pLZ15-); 3, BL 27, L. casei ATCC 393 (pLZ15-); 4, BL 54, L. casei ATCC 393 (pLZ15-); 5, BL 70T, L. casei ATCC 393T; 6, BL 94T, L. casei ATCC 393T; 7, BL 119T, L. casei ATCC 393T.

 
Ribotyping.
Total DNA from the seven strains was digested with EcoRI, HindIII or PstI, transferred to nylon membranes and then hybridized with the PCR-amplified 16S rDNA of BL 94T. The banding patterns of the strains of each group were identical with the three restriction enzymes tested; no statistical analysis was performed due to the evident lack of relatedness between the ribopatterns of the two groups of strains. This confirmed the usefulness of this technique for typing very closely related strains.

All of the strains tested produced five hybridization bands when digested with HindIII and four when digested with EcoRI. However, when digested with PstI, five hybridization bands were obtained for the ATCC 393 (pLZ15-) group and four were obtained for the ATCC 393T group. Table 3Go shows the estimated mean sizes (kbp) of the hybridizing bands for both groups. Southern blot hybridization studies from different authors have shown that the number of bands of greater than 4·5 kb in length often corresponds to the minimum number of rRNA operons (or rrn alleles) in the genome (Sechi & Daneo-Moore, 1993Go; Bourget et al., 1993Go; Moschetti et al., 1997Go). This would suggest that the ATCC 393 (pLZ15-) group possibly has five copies of the rrn genes and that the ATCC 393T group has four copies of the rrn genes.


View this table:
[in this window]
[in a new window]
 
Table 3. Estimated sizes (kbp) of the bands hybridizing with the 16S rDNA probe of L. casei (1500 bp) for both groups of strains

 
Macrorestriction analysis.
Total DNA from the seven strains was cleaved with AscI and SfiI, and a representative strain from each group was cleaved with I-CeuI. AscI cleaved the DNA of ATCC 393 (pLZ15-) and ATCC 393T into 15 and 14 restriction fragments, respectively, whereas SfiI rendered 17 and 11 restriction fragments, respectively. The banding patterns produced with both enzymes were clearly different for the two groups of strains. The sizes of all the bands were estimated (Table 4Go) and were used to calculate the genome sizes for the two groups of strains. When the DNA of the ATCC 393T strains was digested with SfiI, the estimated size of the genome was much greater than that obtained with AscI and I-CeuI. These results were observed repeatedly, indicating that only a partial digestion was occurring with SfiI; for this reason the SfiI data were not considered in the calculations. A similar phenomenon has been reported when other enzymes have been used to digest L. casei (Ferrero et al., 1996Go). Hence, the genome sizes were estimated to be 2491·0±180·6 kbp for ATCC 393 (pLZ15-) and 2031·0±33·2 kbp for ATCC 393T. Previous studies have reported similar genome sizes for L. casei ATCC 393T (2·0 Mb; Chassy, 1976Go) and L. casei ATCC 334 (2·17 Mb; Ferrero et al., 1996Go).


View this table:
[in this window]
[in a new window]
 
Table 4. Sizes (kbp) of the restriction fragments obtained by cleavage of the total genomic DNA of L. casei ATCC 393 (pLZ15-) and ATCC 393T

 
In addition to estimating the genome sizes, the number of ribosomal operons was also estimated for both groups of strains, due to the fact that I-CeuI recognizes an internal sequence in the 23S rRNA gene (Marshall & Lemieux, 1992Go; Liu et al., 1993Go). The number of bands observed when the DNA was digested with this enzyme suggests that there should be five copies of the rrn operon in ATCC 393 (pLZ15-) and four copies of the rrn operon in ATCC 393T (Table 3Go), which exactly coincides with the number of operons estimated by ribotyping.

Data obtained from this set of experiments further prove that ATCC 393T and ATCC 393 (pLZ15-) are genetically different. Although macrorestriction analysis is technically more complex than the other techniques described here, it provides good discrimination between strains and, when performed properly, other useful genomic data, such as the genome size and the number of rrn operons.

ARDRA.
The 16S rDNA of all the strains was amplified by PCR and digested with the restriction enzymes AluI or HinfI. An identical pattern of bands was obtained in all cases (Fig. 3Go). With AluI, the observed band sizes were 610, 240 and 210 bp. The sequence map revealed that the band of 210 bp was actually composed of three fragments with very similar lengths, while a small band of 33 bp could not be detected (33, 207, 207, 213, 248, 614 bp). The sizes of the fragments obtained with HinfI were 980, 290, 190 and 70 bp. Despite the differences found between the two groups of strains with the other molecular techniques used here, ARDRA could not be used to distinguish them, indicating that the resolution threshold of this technique is at a higher taxon level.



View larger version (37K):
[in this window]
[in a new window]
 
Fig. 3. ARDRA patterns of the L. casei strains examined here. After PCR amplification of the 16S rDNA, samples were digested with (a) AluI or (b) HinfI. In both images, samples were loaded as follows: M, size standard, 1 kbp plus DNA ladder (Gibco-BRL); 1, BL 6T, L. casei ATCC 393T; 2, BL 23, L. casei ATCC 393 (pLZ15-); 3, BL 27, L. casei ATCC 393 (pLZ15-); 4, BL 54, L. casei ATCC 393 (pLZ15-); 5, BL 70T, L. casei ATCC 393T; 6, BL 94T, L. casei ATCC 393T; 7, BL 119T, L. casei ATCC 393T.

 
ITS.
The intergenic spacer regions between the 16S–23S rDNA (ITS1) and the 23S–5S rDNA (ITS2) were obtained for both groups of strains by PCR. Both groups showed two ITS1 bands of 220 and 430 bp in size. However, differences could be found upon amplification of the ITS2 region, as ATCC 393 (pLZ15-) strains had two bands with estimated sizes of 230 and 150 bp and ATCC 393T strains displayed four bands with estimated sizes of 610, 410, 250 and 150 bp (Fig. 4Go). Chen et al. (2000)Go described two 23S–5S ITS amplicons for the L. casei–paracasei group with sizes of 250 and 170 bp, which approximately coincide with the sizes we estimated for ITS2 of the ATCC 393 (pLZ15-) strains, indicating that the strain used by these authors as ATCC 393T was possibly the plasmid-cured derivative obtained by Flickinger et al. (1986)Go. This is another example of the great confusion generated when two different strains are circulating as the reference strain.



View larger version (109K):
[in this window]
[in a new window]
 
Fig. 4. Electrophoretic patterns of the (a) ITS1 and (b) ITS2 regions for representative strains from both groups of L. casei studied here. In both images, samples were loaded as follows: M, size standard, 1 kbp plus DNA ladder (Gibco-BRL); 1, BL 23, L. casei ATCC 393 (pLZ15-); 2, BL 94T, L. casei ATCC 393T.

 
rDNA sequencing.
Sequences for the first 560 bp (domain I) of the 16S and 23S rDNAs of all of the strains were determined. When both of the sequences were aligned, complete homology was found between strains of the ATCC 393T group; the three ATCC 393 (pLZ15-) strains also had identical sequences. However, similarity levels between both groups of strains were 97·7 % (16S domain I) and 97·8 % (23S domain I), with evolutionary distances of knuc=0·023 and knuc=0·022, respectively, as determined by the algorithm of Saitou & Nei (1987)Go.

Positions of the variable bases in domain I of the 16S rDNA sequence were identified using sequences from the Ribosomal Database Project (RDP). They coincided with those published previously, which were in the region of the first 90 nt of the sequence; the signature sequence was also located in positions 47–85 (Mori et al., 1997Go).

Unfortunately, there are no complete sequences available for domain I of the 23S rDNA of the L. casei group; therefore, alignments could not be produced. However, nucleotide differences between our strains could be identified between positions 110 and 132, which contained the likely 23S domain I signature sequence (data not shown). The partial 23S rDNA sequences of strains BL 23 and BL 94T have been deposited in GenBank under accession nos AY112675 and AY112676, respectively.

The G+C content of the 16S rDNA sequence was 52 mol% for ATCC 393 (pLZ15-) and 51 mol% for ATCC 393T; for the 23S rDNA domain I sequence, the G+C content was 53 mol% for ATCC 393 (pLZ15-) and 52 mol% for ATCC 393T.

The complete sequence of the 16S rDNA (1518 nt) was then determined for BL 23 (GenBank accession no. AF385770) and BL 94T (GenBank accession no. AF469172), representing ATCC 393 (pLZ15-) and ATCC 393T, respectively. The sequence of strain ATCC 393T was 100 % similar to another reported 16S rDNA sequence of L. casei ATCC 393T (GenBank accession no. D16551) and 99 % similar to the 16S rDNA sequence of L. zeae ATCC 15820T (GenBank accession no. D86516). Most notably, the 16S rDNA sequence of ATCC 393 (pLZ15-) was 100 % similar to that of Lactobacillus paracasei subsp. paracasei ATCC 4022 (GenBank accession no. D79212). Strain L. casei BL 23 has been deposited in the Spanish National Culture Collection under reference no. CECT 5275T.

Many authors have proposed that L. casei ATCC 393T should be reassigned to the species L. zeae and that another strain should be proposed as the neotype of L. casei (e.g. Dellaglio et al., 1991Go; Dicks et al., 1996Go); however, this proposal was rejected by the Judicial Commission of the International Committee on Systematic Bacteriology (Wayne, 1994Go). In the present work, strains regularly used as ATCC 393T were examined and it was found that the four strains obtained from accredited type-culture collections were identical and were similar to L. zeae, as described previously, but strains received as plasmid-cured variants of L. casei ATCC 393T were identical to L. paracasei.

The history of the plasmid-cured derivative of ATCC 393T starts in the early 1970s, when B. Chassy carried out a number of biochemical and genetic studies on the L. casei ATCC 393T strain obtained from the American Type Culture Collection (personal communication). As consequence of this work, ATCC 393 (pLZ15-), which was later widely distributed, was obtained. However, the main conclusion of the present work is that strains ATCC 393T and ATCC 393 (pLZ15-) are phenotypically and genetically different. In fact, although their 16S and 23S rDNAs have highly similar sequences (97·7–97·8 %), according to the taxonomic structure of this group these strains should, at present, be included in different species, L. casei and L. paracasei, respectively. Therefore, the ancestral strain of ATCC 393 (pLZ15-) has never been the strain that is now held in culture collections.


    ACKNOWLEDGEMENTS
 
This work has been financed by project ALI98-0714 of the Spanish Commission for Science and Technology (CICYT). E. Acedo-Félix was supported by a grant of the Spanish Instituto para la Cooperación con Iberamérica. We wish to thank M. Santos and especially R. Tenreiro from the University of Lisbon for kindly helping with the PFGE technique and J. L. Galán for his assistance with the statistics and computing work.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS AND DISCUSSION
 REFERENCES
 
Alvarez, M. A., Rodriguez, A. & Suarez, J. E. (1999). Stable expression of the Lactobacillus casei bacteriophage A2 repressor blocks phage propagation during milk fermentation. J Appl Microbiol 86, 812–816.[CrossRef][Medline]

Anderson, D. G. & McKay, L. L. (1983). Simple and rapid method for isolating large plasmid DNA from lactic streptococci. Appl Environ Microbiol 46, 549–552.[Abstract/Free Full Text]

Billot-Klein, D., Legrand, R., Schoot, B., van Heinjenoort, J. & Gutmann, L. (1997). Peptidoglycan structure of Lactobacillus casei, a species highly resistant to glycopeptide antibiotics. J Bacteriol 179, 6208–6212.[Abstract/Free Full Text]

Bourget, N., Simonet, J. M. & Decaris, B. (1993). Analysis of the genome of the five Bifidobacterium breve strains: plasmid content, pulsed-field gel electrophoresis genome size estimation and rrn loci number. FEMS Microbiol Lett 110, 11–20.[CrossRef][Medline]

Chaillou, S., Pouwels, P. H. & Postma, P. W. (1999). Transport of D-xylose in Lactobacillus pentosus, Lactobacillus casei, and Lactobacillus plantarum: evidence for a mechanism of facilitated diffusion via the phosphoenolpyruvate : mannose phosphotransferase system. J Bacteriol 181, 4768–4773.[Abstract/Free Full Text]

Chassy, B. M. (1976). A gentle method for the lysis of oral streptococci. Biochem Biophys Res Commun 68, 603–608.[CrossRef][Medline]

Chassy, B. M. & Alpert, C. A. (1989). Molecular characterization of the plasmid-encoded lactose-PTS of Lactobacillus casei. FEMS Microbiol Rev 63, 157–166.

Chassy, B. M. & Flickinger, J. L. (1987). Transformation of Lactobacillus casei by electroporation. FEMS Microbiol Lett 44, 173–177.[CrossRef]

Chassy, B. M. & Giuffrida, A. (1980). Method for the lysis of Gram-positive, asporogenous bacteria with lysozyme. Appl Environ Microbiol 39, 153–158.[Abstract/Free Full Text]

Chassy, B. M., Gibson, E. & Giuffrida, A. (1976). Evidence for extrachromosomal elements in Lactobacillus. J Bacteriol 127, 1576–1578.[Abstract/Free Full Text]

Chen, H., Lim, C. K., Lee, Y. K. & Chan, Y. N. (2000). Comparative analysis of the genes encoding 23S–5S rRNA intergenic spacer regions of Lactobacillus casei-related strains. Int J Syst Evol Microbiol 50, 471–478.[Abstract]

Clark, A. G. & Lanigan, C. M. S. (1993). Prospects for estimating nucleotide divergence with RAPDs. Mol Biol Evol 10, 1096–1111.[Abstract]

Collins, M. D., Phillips, B. A. & Zanoni, P. (1989). Deoxyribonucleic acid homology studies of Lactobacillus casei, Lactobacillus paracasei sp. nov., subsp. paracasei and subsp. tolerans, and Lactobacillus rhamnosus sp. nov., comb. nov. Int J Syst Bacteriol 39, 105–108.

Coullon, S., Chemardin, P., Gueguen, Y., Arnaud, A. & Glazy, P. (1998). Purification and characterization of an intracellular {beta}-glucosidase from Lactobacillus casei ATCC 393. Appl Biochem Biotechnol 74, 104–114.

Dellaglio, F., Bottazzi, V. & Vescovo, M. (1975). Deoxyribonucleic acid homology among Lactobacillus species of the subgenus Streptobacterium Orla-Jensen. Int J Syst Bacteriol 25, 160–172.

Dellaglio, F., Dicks, L. M. T., Du Toit, M. & Torriani, S. (1991). Designation of ATCC 334 in place of ATCC 393 (NCDO 161) as the neotype strain of Lactobacillus casei subsp. casei and rejection of the name Lactobacillus paracasei (Collins et al., 1981). Request for an opinion. Int J Syst Bacteriol 41, 340–342.[Abstract/Free Full Text]

Dicks, L. M. T., Du Pleiss, E. M., Dellaglio, F. & Lauer, E. (1996). Reclassification of Lactobacillus casei subsp. casei ATCC 393 and Lactobacillus rhamnosus ATCC 15820 as Lactobacillus zeae nom. rev., designation of ATCC 334 as the neotype of L. casei subsp. casei, and rejection of the name Lactobacillus paracasei. Int J Syst Bacteriol 46, 337–340.[Abstract/Free Full Text]

Dossonnet, V., Monedero, V., Zagorec, M., Galinier, A., Pérez-Martínez, G. & Deutscher, J. (2000). Phosphorylation of HPr by the bifunctional HPr Kinase/P-ser-HPr phosphatase from Lactobacillus casei controls catabolite repression and inducer exclusion but not inducer expulsion. J Bacteriol 182, 2582–2590.[Abstract/Free Full Text]

Felis, G. E., Dellaglio, F., Mizzi, L. & Torriani, S. (2001). Comparative sequence analysis of a recA gene fragment brings new evidence for a change in the taxonomy of the Lactobacillus casei group. Int J Syst Evol Microbiol 51, 2113–2117.[Abstract]

Ferrero, M., Cesena, C., Morelli, L., Scolari, G. & Vescovo, M. (1996). Molecular characterization of Lactobacillus casei strains. FEMS Microbiology Lett 140, 215–219.[CrossRef]

Flickinger, J. L., Porter, E. V. & Chassy, B. M. (1986). Molecular cloning of a plasmid-encoded {beta}-galactosidase from Lactobacillus casei. In Abstracts of the 86th General Meeting of the American Society of Microbiology 1986, abstract H-179, p. 156. Washington, DC: American Society for Microbiology.

Gordon, G. L. & Doelle, H. W. (1976). Purification, properties and immunological relationship of L(+)-lactate dehydrogenase from Lactobacillus casei. Eur J Biochem 67, 543–555.[Medline]

Gosalbes, M. J., Monedero, V., Alpert, C.-A. & Pérez-Martínez, G. (1997). Establishing a model to study the regulation of the lactose operon in Lactobacillus casei. FEMS Microbiol Lett 148, 83–89.[CrossRef][Medline]

Gosalbes, M. J., Monedero, V. & Pérez-Martínez, G. (1999). Elements involved in catabolite repression and induction of the lactose operon in Lactobacillus casei. J Bacteriol 181, 3928–3934.[Abstract/Free Full Text]

Gosalbes, M. J., Esteban, C. D., Galán, J. L. & Pérez-Martínez, G. (2000). Integrative food-grade expression system based on the lactose regulon of Lactobacillus casei. Appl Environ Microbiol 66, 4822–4828.[Abstract/Free Full Text]

Gosalbes, M. J., Pérez-Arellano, I., Esteban, C. D., Galán, J. L. & Pérez-Martínez, G. (2001). Use of lac regulatory elements for gene expression in Lactobacillus casei. Lait 81, 29–35.[CrossRef]

Heath, J. D., Perkins, J. D., Sharma, B. & Weinstock, G. M. (1992). NotI genomic cleavage map of Escherichia coli K-12 strain MG1655. J Bacteriol 174, 558–567.[Abstract/Free Full Text]

Hegazi, F. Z. & Abo-Elanga, I. G. (1987). Proteolytic activity of crude cell-free extract of Lactobacillus casei and Lactobacillus plantarum. Nahrung 31, 225–232.[Medline]

Hemme, D., Gaier, W., Winters, D. A., Foucaud, C. & Vogel, R. F. (1994). Expression of Lactobacillus casei ATCC 393 {beta}-galactosidase encoded by plasmid pLZ15 in Lactococcus lactis CNRZ 1123. Lett Appl Microbiol 19, 345–348.[Medline]

Hensel, R., Mayr, U., Stetter, K. O. & Kandler, O. (1977). Comparative studies of lactic acid dehydrogenases in lactic acid bacteria. I. Purification and kinetics of the allosteric L-lactic acid dehydrogenase from Lactobacillus casei ssp. casei and Lactobacillus curvatus. Arch Microbiol 112, 81–93.[CrossRef][Medline]

Hols, P., Slos, P., Dutot, P., Reymund, J., Chabot, P., Delplace, B., Delcour, J. & Mercenier, A. (1997). Efficient secretion of the model antigen M6-gp41E in Lactobacillus plantarum NCIMB 8826. Microbiology 143, 2733–2741.[Abstract/Free Full Text]

Kim, S. F., Baek, S. J. & Pack, M. Y. (1991). Cloning and nucleotide sequence of the Lactobacillus casei lactate dehydrogenase gene. Appl Environ Microbiol 57, 2413–2417.[Abstract/Free Full Text]

Lane, D. J. (1991). 16S/23S rRNA sequencing. In Nucleic Acid Techniques in Bacterial Systematics, chapter 6, pp. 115–175. Edited by E. Stackebrandt & M. Goodfellow. Chichester: Wiley.

Leer, R. J., van Luijk, N., Posno, M. & Pouwels, P. H. (1992). Structural and functional analysis of two cryptic plasmids from Lactobacillus pentosus MD353 and Lactobacillus plantarum ATCC 8014. Mol Gen Genet 234, 265–274.[Medline]

Lee-Wickner, L. J. & Chassy, B. M. (1984). Production and regeneration of Lactobacillus casei protoplasts. Appl Environ Microbiol 48, 994–1000.[Abstract/Free Full Text]

Lee-Wickner, L. J. & Chassy, B. M. (1985). Characterization and molecular cloning for cryptic plasmids isolated from Lactobacillus casei. Appl Environ Microbiol 49, 1154–1161.[Abstract/Free Full Text]

Liu, S.-L., Hessel, A. & Sanderson, K. E. (1993). Genomic mapping with I-CeuI, an intron-encoded endonuclease specific for genes for ribosomal RNA, in Salmonella spp., Escherichia coli, and other bacteria. Proc Natl Acad Sci U S A 90, 6874–6878.[Abstract/Free Full Text]

Maassen, C. B. M., Laman, J. D. & den Bak-Glashouwer, M. J. (1999). Instruments for oral disease-intervention strategies: recombinant Lactobacillus casei expressing tetanus toxin fragment C for vaccination or myelin proteins for oral tolerance induction in multiple sclerosis. Vaccine 17, 2117–2128.[CrossRef][Medline]

Marshall, P. & Lemieux, C. (1992). The I-CeuI endonuclease recognizes a sequence of 19 base pairs and preferentially cleaves the coding strand of the Chlamydomonas moewusii chloroplast large subunit rRNA gene. Nucleic Acids Res 20, 6401–6407.[Abstract/Free Full Text]

Mills, C. K. & Lessel, E. F. (1973). Lactobacterium zeae Kuznestov, a later subjective synonym of Lactobacillus casei (Orla-Jensen) Hansen and Lessel. Int J Syst Bacteriol 23, 430–432.[Abstract/Free Full Text]

Monedero, V., Gosalbes, M. J. & Pérez-Martínez, G. (1997). Catabolite repression in Lactobacillus casei ATCC 393 is mediated by CcpA. J Bacteriol 179, 6657–6664.[Abstract/Free Full Text]

Mori, K., Yamazaki, K., Ishiyama, T., Katsumata, M., Kobayashi, K., Kawai, Y., Inoue, N. & Shinano, H. (1997). Comparative sequence analyses of the gene coding for 16S rRNA of Lactobacillus casei-related taxa. Int J Syst Bacteriol 47, 54–57.[Abstract/Free Full Text]

Moschetti, G., Blaiotta, G., Aponte, M., Mauriello, G., Villani, F. & Coppola, S. (1997). Genotyping of Lactobacillus delbrueckii subsp. bulgaricus and determination of the number and forms of rrn operons in L. delbrueckii and its subspecies. Res Microbiol 148, 501–510.[Medline]

Murray, R. G. E., Doetsch, R. N. & Robinow, C. F. (1994). Determinative and cytological light microscopy. In Methods for General and Molecular Bacteriology, pp. 21–41. Edited by P. Gerhardt, R. G. E. Murray, W. A. Wood & N. R. Krieg. Washington, DC: American Society for Microbiology.

Nour, M. (1998). 16S–23S and 23S–5S intergenic spacer regions of lactobacilli: nucleotide sequence, secondary structure and comparative analysis. Res Microbiol 149, 433–448.[Medline]

Palles, T., Beresford, T., Condon, S. & Cogan, T. M. (1998). Citrate metabolism in Lactobacillus casei and Lactobacillus plantarum. J Appl Microbiol 85, 147–154.[CrossRef]

Pelletier, C., Bouley, C., Cayuela, C., Bouttier, S., Bourlioux, P. & Bellon-Fontaine, M.-N. (1997). Cell surface characteristics of Lactobacillus casei subsp. casei, Lactobacillus paracasei subsp. paracasei, and Lactobacillus rhamnosus strains. Appl Environ Microbiol 63, 1725–1731.[Abstract]

Pérez-Arellano, I., Zúñiga, M. & Pérez-Martínez, G. (2001). Construction of compatible wide-host-range shuttle vectors for lactic acid bacteria and Escherichia coli. Plasmid 46, 106–116.[CrossRef][Medline]

Saitou, N. & Nei, M. (1987). The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol Biol Evol 4, 406–425.[Abstract]

Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning: a Laboratory Manual, 2nd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.

Sechi, L. A. & Daneo-Moore, L. (1993). Characterization of intergenic spacers in two rrn operons of Enterococcus hirae ATCC 9790. J Bacteriol 175, 3213–3219.[Abstract/Free Full Text]

Stingele, F., Neeser, J.-R. & Mollet, B. (1996). Identification and characterization of the eps (exopolysaccharide) gene cluster from Streptococcus thermophilus Sfi6. J Bacteriol 178, 1680–1690.[Abstract/Free Full Text]

Tenreiro, R., Santos, M. A., Paveia, H. & Vieira, G. (1994). Inter-strain relationships among wine leuconostocs and their divergence from other Leuconostoc species, as revealed by low frequency restriction fragment analysis of genomic DNA. J Appl Bacteriol 77, 271–280.[Medline]

Veyrat, A., Monedero, V. & Pérez-Martínez, G. (1994). Glucose transport by the phosphoenolpyruvate : mannose phosphotransferase system in Lactobacillus casei ATCC 393 and its role in carbon catabolite repression. Microbiology 140, 1141–1149.[Abstract/Free Full Text]

Veyrat, A., Miralles, M. C. & Pérez-Martínez, G. (1999). A fast method for monitoring the colonization rate of lactobacilli in a meat model system. J Appl Microbiol 87, 49–61.[CrossRef][Medline]

Viana, R., Monedero, V., Dossonnet, V., Pérez-Martínez, G. & Deutscher, J. (2000). Enzyme I and HPr from Lactobacillus casei: their role in sugar transport, catabolite repression and inducer exclusion. Mol Microbiol 36, 570–584.[CrossRef][Medline]

Wayne, L. G. (1994). Actions of the Judicial Commission of the International Committee on Systematic Bacteriology on Requests for Opinions published between January 1985 and July 1993. Int J Syst Bacteriol 44, 177–178.[Abstract/Free Full Text]

Welsh, J. & McClelland, M. (1990). Fingerprinting genomes using PCR with arbitrary primers. Nucleic Acids Res 18, 7213–7218.[Abstract/Free Full Text]

Yebra, M. J., Veyrat, A., Santos, M. A. & Pérez-Martínez, G. (2000). Genetics of L-sorbose transport and metabolism in Lactobacillus casei. J Bacteriol 182, 155–163.[Abstract/Free Full Text]

Zhong, W., Millsap, K., Bialkowska-Hobrzanska, H. & Reid, G. (1998). Differentiation of Lactobacillus species by molecular typing. Appl Environ Microbiol 64, 2418–2423.[Abstract/Free Full Text]




This article has been cited by other articles:


Home page
Gen Biol EvolHome page
H. Cai, R. Thompson, M. F. Budinich, J. R. Broadbent, and J. L. Steele
Genome Sequence and Comparative Genome Analysis of Lactobacillus casei: Insights into Their Niche-Associated Evolution
Gen Biol Evol, September 23, 2009; 2009(0): 239 - 257.
[Abstract] [Full Text] [PDF]


Home page
Appl. Environ. Microbiol.Home page
A. Kajikawa and S. Igimi
Reduction of Tumor Necrosis Factor Alpha-Inducing Capacity of Recombinant Lactobacillus casei via Expression of Salmonella OmpC
Appl. Envir. Microbiol., May 1, 2009; 75(9): 2727 - 2734.
[Abstract] [Full Text] [PDF]


Home page
Appl. Environ. Microbiol.Home page
L. Diancourt, V. Passet, C. Chervaux, P. Garault, T. Smokvina, and S. Brisse
Multilocus Sequence Typing of Lactobacillus casei Reveals a Clonal Population Structure with Low Levels of Homologous Recombination
Appl. Envir. Microbiol., October 15, 2007; 73(20): 6601 - 6611.
[Abstract] [Full Text] [PDF]


Home page
Appl. Environ. Microbiol.Home page
S. Hazebrouck, R. Oozeer, K. Adel-Patient, P. Langella, S. Rabot, J.-M. Wal, and G. Corthier
Constitutive Delivery of Bovine {beta}-Lactoglobulin to the Digestive Tracts of Gnotobiotic Mice by Engineered Lactobacillus casei
Appl. Envir. Microbiol., December 1, 2006; 72(12): 7460 - 7467.
[Abstract] [Full Text] [PDF]


Home page
Appl. Environ. Microbiol.Home page
T. Rochat, J.-J. Gratadoux, A. Gruss, G. Corthier, E. Maguin, P. Langella, and M. van de Guchte
Production of a Heterologous Nonheme Catalase by Lactobacillus casei: an Efficient Tool for Removal of H2O2 and Protection of Lactobacillus bulgaricus from Oxidative Stress in Milk
Appl. Envir. Microbiol., August 1, 2006; 72(8): 5143 - 5149.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
A. Maze, G. Boel, S. Poncet, I. Mijakovic, Y. Le Breton, A. Benachour, V. Monedero, J. Deutscher, and A. Hartke
The Lactobacillus casei ptsHI47T Mutation Causes Overexpression of a LevR-Regulated but RpoN-Independent Operon Encoding a Mannose Class Phosphotransferase System
J. Bacteriol., July 15, 2004; 186(14): 4543 - 4555.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Acedo-Félix, E.
Right arrow Articles by Pérez-Martínez, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Acedo-Félix, E.
Right arrow Articles by Pérez-Martínez, G.
Agricola
Right arrow Articles by Acedo-Félix, E.
Right arrow Articles by Pérez-Martínez, G.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
INT J SYST EVOL MICROBIOL MICROBIOLOGY J GEN VIROL
J MED MICROBIOL ALL SGM JOURNALS